Review




Structured Review

Addgene inc px330
Px330, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2984 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pm41928626-196-3-4
Average 96 stars, based on 2984 article reviews
px330 - by Bioz Stars, 2026-09
96/100 stars

Images

Related Articles

CRISPR:

Article Title: Compositions, kits and methods for weed control
Article Snippet: .. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene. ..

Article Title: Genome-edited birds
Article Snippet: .. CRISPR plasmids are publicly available such as the px330 plasmid from Addgene. ..

Article Title: Regulation of feed efficiency and methane production in ruminating animals
Article Snippet: .. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene. ..

Plasmid Preparation:

Article Title: Compositions, kits and methods for weed control
Article Snippet: .. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene. ..

Article Title: Phosphorylation of Runx protein controls helper CD4 + T cell versus cytotoxic CD8 + T cell lineage choice
Article Snippet: .. Zygotes generated from C57BL/6NJcl strain purchased from CLEA Japan were injected with mRNA encoding humanized S. pyogenes Cas9 that was invitro transcribed from pX330 plasmid (#42230, Addgene), single guide RNA (sgRNA) and single strand donor DNA, both of which were synthesized at Integrated DNA Technology. ..

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6-pyrG-sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R (Table S1). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6- pyrG -sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R ( ). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Article Title: TRIM29 knockout pigs exhibit enhanced broad-spectrum disease resilience by amplifying type I interferon antiviral defenses
Article Snippet: .. Primary PFFs were isolated from a male Yorkshire pig fetus and transfected with the PX330 plasmid (#42230, Addgene) harboring the spCas9 gene and a gRNA targeting the exon 1 region of pig TRIM29 (GACCTCCAGCTACTTCAGCATGG) using the Nucleofector system (LONZA). ..

Article Title: TRIM29 knockout pigs exhibit enhanced broad-spectrum disease resilience by amplifying type I interferon antiviral defenses.
Article Snippet: .. Primary PFFs were isolated from a male Yorkshire pig fetus and transfected with the PX330 plasmid (#42230, Addgene) harboring the spCas9 gene and a gRNA targeting the exon 1 region of pig TRIM29 (GACCTCCAGCTACTTCAGCATGG) using the Nucleofector system (LONZA). ..

Article Title: Genome-edited birds
Article Snippet: .. CRISPR plasmids are publicly available such as the px330 plasmid from Addgene. ..

Article Title: Regulation of feed efficiency and methane production in ruminating animals
Article Snippet: .. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene. ..

Generated:

Article Title: Phosphorylation of Runx protein controls helper CD4 + T cell versus cytotoxic CD8 + T cell lineage choice
Article Snippet: .. Zygotes generated from C57BL/6NJcl strain purchased from CLEA Japan were injected with mRNA encoding humanized S. pyogenes Cas9 that was invitro transcribed from pX330 plasmid (#42230, Addgene), single guide RNA (sgRNA) and single strand donor DNA, both of which were synthesized at Integrated DNA Technology. ..

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6-pyrG-sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R (Table S1). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6- pyrG -sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R ( ). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Injection:

Article Title: Phosphorylation of Runx protein controls helper CD4 + T cell versus cytotoxic CD8 + T cell lineage choice
Article Snippet: .. Zygotes generated from C57BL/6NJcl strain purchased from CLEA Japan were injected with mRNA encoding humanized S. pyogenes Cas9 that was invitro transcribed from pX330 plasmid (#42230, Addgene), single guide RNA (sgRNA) and single strand donor DNA, both of which were synthesized at Integrated DNA Technology. ..

Synthesized:

Article Title: Phosphorylation of Runx protein controls helper CD4 + T cell versus cytotoxic CD8 + T cell lineage choice
Article Snippet: .. Zygotes generated from C57BL/6NJcl strain purchased from CLEA Japan were injected with mRNA encoding humanized S. pyogenes Cas9 that was invitro transcribed from pX330 plasmid (#42230, Addgene), single guide RNA (sgRNA) and single strand donor DNA, both of which were synthesized at Integrated DNA Technology. ..

Expressing:

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6-pyrG-sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R (Table S1). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6- pyrG -sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R ( ). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Sequencing:

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6-pyrG-sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R (Table S1). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Article Title: A High-Efficiency CRISPR–Cas9 Ribonucleoprotein Genome Editing System in Aspergillus fijiensis Enabled by Microhomology-Mediated End Joining
Article Snippet: .. The sgRNA expression plasmid pPu6- pyrG -sgRNA was first generated by amplifying the gRNA scaffold sequence from pX330 plasmid (Addgene, Watertown, MA, USA, #42230) using primers gRNA-scaffold-F and gRNA-scaffold-R ( ). .. PCR amplification was performed with PrimeSTAR Max High-Fidelity DNA Polymerase (Takara, Nishinomiya, Japan), according to the manufacturer’s instructions.

Isolation:

Article Title: TRIM29 knockout pigs exhibit enhanced broad-spectrum disease resilience by amplifying type I interferon antiviral defenses
Article Snippet: .. Primary PFFs were isolated from a male Yorkshire pig fetus and transfected with the PX330 plasmid (#42230, Addgene) harboring the spCas9 gene and a gRNA targeting the exon 1 region of pig TRIM29 (GACCTCCAGCTACTTCAGCATGG) using the Nucleofector system (LONZA). ..

Article Title: TRIM29 knockout pigs exhibit enhanced broad-spectrum disease resilience by amplifying type I interferon antiviral defenses.
Article Snippet: .. Primary PFFs were isolated from a male Yorkshire pig fetus and transfected with the PX330 plasmid (#42230, Addgene) harboring the spCas9 gene and a gRNA targeting the exon 1 region of pig TRIM29 (GACCTCCAGCTACTTCAGCATGG) using the Nucleofector system (LONZA). ..

Transfection:

Article Title: TRIM29 knockout pigs exhibit enhanced broad-spectrum disease resilience by amplifying type I interferon antiviral defenses
Article Snippet: .. Primary PFFs were isolated from a male Yorkshire pig fetus and transfected with the PX330 plasmid (#42230, Addgene) harboring the spCas9 gene and a gRNA targeting the exon 1 region of pig TRIM29 (GACCTCCAGCTACTTCAGCATGG) using the Nucleofector system (LONZA). ..

Article Title: TRIM29 knockout pigs exhibit enhanced broad-spectrum disease resilience by amplifying type I interferon antiviral defenses.
Article Snippet: .. Primary PFFs were isolated from a male Yorkshire pig fetus and transfected with the PX330 plasmid (#42230, Addgene) harboring the spCas9 gene and a gRNA targeting the exon 1 region of pig TRIM29 (GACCTCCAGCTACTTCAGCATGG) using the Nucleofector system (LONZA). ..



Similar Products

96
Addgene inc px330
Px330, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pm41928626-196-3-4
Average 96 stars, based on 1 article reviews
px330 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

92
Addgene inc addgene plasmid
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-Puro-ccdB+(Plasmid+%2382580)/pm41875887-830-60-60
Average 92 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

96
Addgene inc px330 addgene
Px330 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pm41928626-296-170-171
Average 96 stars, based on 1 article reviews
px330 addgene - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

92
Addgene inc px330 puro
Px330 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-Puro-ccdB+(Plasmid+%2382580)/pm41875887-878-8-9
Average 92 stars, based on 1 article reviews
px330 puro - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
Addgene inc px330 sgsox9 pt3 myrakt ha mouse 10 addgene
Px330 Sgsox9 Pt3 Myrakt Ha Mouse 10 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pT3-Neo-EF1a-GFP+(Plasmid+%2369134)/pm41928626-296-131-136
Average 93 stars, based on 1 article reviews
px330 sgsox9 pt3 myrakt ha mouse 10 addgene - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Addgene inc px330 u6 chimeric bb cbh hspcas9 plasmid
Px330 U6 Chimeric Bb Cbh Hspcas9 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc13043746-359-8-10
Average 96 stars, based on 1 article reviews
px330 u6 chimeric bb cbh hspcas9 plasmid - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Addgene inc px330 puro plasmid
Px330 Puro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330%2Epuro+(Plasmid+%23110403)/pm41932441-287-19-35
Average 93 stars, based on 1 article reviews
px330 puro plasmid - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Addgene inc plasmid
Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pmc13000946-45-20-22
Average 96 stars, based on 1 article reviews
plasmid - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Addgene inc spcas9 plasmid px330 u6 chimeric bb cbh hspcas9
Spcas9 Plasmid Px330 U6 Chimeric Bb Cbh Hspcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__64898__2026__03__30__715331-151-5-8
Average 96 stars, based on 1 article reviews
spcas9 plasmid px330 u6 chimeric bb cbh hspcas9 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
Addgene inc px330 plasmid
Px330 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px330+plasmid/px330+EQR+(Plasmid+%23101733)/us12588681-509-8-11
Average 94 stars, based on 1 article reviews
px330 plasmid - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results